Detail of EST/Unigene AL376333 |
Acc. | AL376333 |
Internal Acc. | MtBB22H12R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Brassica napus E-value=2e-16; Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=4e-15; Thioredoxin M2, chloroplastic OS=Arabidopsis thaliana E-value=1e-14; Thioredoxin M1, chloroplastic OS=Arabidopsis thaliana E-value=2e-14; Thioredoxin M2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-14; |
Length | 506 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | TCTTCGCTCCATTGTGTAGCCCCTGCAAGAATGTTGATTTCAAAATGGTTGAGCTGGCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825653 |
Trichome-related Gene from Literature | N/A |