| Detail of EST/Unigene AL376706 |
| Acc. | AL376706 |
| Internal Acc. | MtBB25E11F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase delta chain, chloroplastic OS=Pisum sativum E-value=3e-29; ATP synthase delta chain, chloroplastic OS=Nicotiana tabacum E-value=5e-27; ATP synthase delta chain, chloroplastic OS=Spinacia oleracea E-value=4e-26; ATP synthase delta chain, chloroplastic OS=Sorghum bicolor E-value=1e-21; ATP synthase delta chain, chloroplastic OS=Chlamydomonas reinhardtii E-value=3e-10; |
| Length | 364 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | GTGAAATTGGAGTCTCAGCATTTGGCGCAGATTGCGAAACAGGTGCAGAAACTTACTGGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826551 |
| Trichome-related Gene from Literature | N/A |