Detail of EST/Unigene AL377071 |
Acc. | AL377071 |
Internal Acc. | MtBB29B10R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Malonate--CoA ligase OS=Arabidopsis thaliana E-value=1e-33; Acyl-CoA synthetase family member 3, mitochondrial OS=Mus musculus E-value=1e-16; Acyl-CoA synthetase family member 3, mitochondrial OS=Bos taurus E-value=2e-16; Acyl-CoA synthetase family member 3, mitochondrial OS=Homo sapiens E-value=4e-15; Acyl-CoA synthetase family member 3, mitochondrial OS=Xenopus laevis E-value=1e-14; |
Length | 416 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | ATTAGAAATTGAATCAGTAATATTAGAGCATCCAACTGTCTCAGAATGTTGCGTTTTGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase |
EC | 6.2.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820862 |
Trichome-related Gene from Literature | N/A |