| Detail of EST/Unigene AL377071 |
| Acc. | AL377071 |
| Internal Acc. | MtBB29B10R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Malonate--CoA ligase OS=Arabidopsis thaliana E-value=1e-33; Acyl-CoA synthetase family member 3, mitochondrial OS=Mus musculus E-value=1e-16; Acyl-CoA synthetase family member 3, mitochondrial OS=Bos taurus E-value=2e-16; Acyl-CoA synthetase family member 3, mitochondrial OS=Homo sapiens E-value=4e-15; Acyl-CoA synthetase family member 3, mitochondrial OS=Xenopus laevis E-value=1e-14; |
| Length | 416 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | ATTAGAAATTGAATCAGTAATATTAGAGCATCCAACTGTCTCAGAATGTTGCGTTTTGGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase |
| EC | 6.2.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820862 |
| Trichome-related Gene from Literature | N/A |