Detail of EST/Unigene AL377135 |
Acc. | AL377135 |
Internal Acc. | MtBB29F03F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Tagetes erecta E-value=1e-69; Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=4e-69; Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=7e-69; Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=4e-68; Zeta-carotene desaturase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=8e-65; |
Length | 431 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | AATCTGCTGATGGGAGCACTTATGTTACAGGACTTTCCTTGTCAAAGGCTACTGAGAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819647 |
Trichome-related Gene from Literature | N/A |