Detail of EST/Unigene AL377639 |
Acc. | AL377639 |
Internal Acc. | MtBB32H04R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lipoxygenase 6, choloroplastic OS=Arabidopsis thaliana E-value=2e-11; Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=2e-09; Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=7e-09; Putative lipoxygenase 5 OS=Oryza sativa subsp. japonica E-value=2e-08; Lipoxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-08; |
Length | 308 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | AAATTATAAATGCAAGAAATAAGGATCCAAGTTTGAAAAGTAGAACTGGTGCAGGTGTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843077 |
Trichome-related Gene from Literature | N/A |