| Detail of EST/Unigene AL377673 |
| Acc. | AL377673 |
| Internal Acc. | MtBB33B03F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | N-carbamoylputrescine amidase OS=Solanum tuberosum E-value=8e-83; N-carbamoylputrescine amidase OS=Solanum lycopersicum E-value=1e-82; N-carbamoylputrescine amidase OS=Arabidopsis thaliana E-value=2e-77; N-carbamoylputrescine amidase OS=Oryza sativa subsp. japonica E-value=6e-76; Omega-amidase NIT2-B OS=Xenopus laevis E-value=1e-13; |
| Length | 475 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | CAGTTTGCTTGCACCGATGATGTCTCAACCAATGTTACCACTGCCGAAAGACTTGTTCGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01431 beta-ureidopropionase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01431 beta-ureidopropionase |
| EC | 3.5.1.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817290 |
| Trichome-related Gene from Literature | N/A |