| Detail of EST/Unigene AL378333 |
| Acc. | AL378333 |
| Internal Acc. | MtBB37E07F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Vacuolar-sorting receptor 1 OS=Pisum sativum E-value=2e-83; Vacuolar-sorting receptor 4 OS=Arabidopsis thaliana E-value=5e-73; Vacuolar-sorting receptor 3 OS=Arabidopsis thaliana E-value=1e-72; Vacuolar-sorting receptor 1 OS=Arabidopsis thaliana E-value=3e-57; Vacuolar-sorting receptor 2 OS=Arabidopsis thaliana E-value=1e-53; |
| Length | 477 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | GCAATTCAAAGGAGACGGTTATACAACTTGTGAAGTCGGTGGACCTGGGCGTTGCAAGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04357 epidermal growth factor; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04357 epidermal growth factor; Environmental Information Processing > Signaling Molecules and Interaction > ko04060 Cytokine-cytokine receptor interaction > K04357 epidermal growth factor |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 815960 |
| Trichome-related Gene from Literature | N/A |