Detail of EST/Unigene AL378412 |
Acc. | AL378412 |
Internal Acc. | MtBB38A12F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-ureidopropionase OS=Homo sapiens E-value=7e-56; Beta-ureidopropionase OS=Rattus norvegicus E-value=3e-55; Beta-ureidopropionase OS=Mus musculus E-value=3e-55; Beta-ureidopropionase OS=Pongo abelii E-value=6e-55; Beta-ureidopropionase OS=Dictyostelium discoideum E-value=1e-52; |
Length | 478 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | GGGGAATCAACTGAATTTTTGCGAAGCTTTGCACTGAAGTATAACATGGTGATTATAAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01431 beta-ureidopropionase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01431 beta-ureidopropionase |
EC | 3.5.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836558 |
Trichome-related Gene from Literature | N/A |