| Detail of EST/Unigene AL378678 |
| Acc. | AL378678 |
| Internal Acc. | MtBB39G08F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Flap endonuclease 1 OS=Glycine max E-value=1e-64; Flap endonuclease 1 OS=Arabidopsis thaliana E-value=2e-61; Flap endonuclease 1-A OS=Sorghum bicolor E-value=9e-59; Flap endonuclease 1 OS=Zea mays E-value=3e-58; Flap endonuclease 1-A OS=Oryza sativa subsp. japonica E-value=3e-58; |
| Length | 448 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | AAAGATTTTGGAGGAGCTAGATTTGACCATGGACCAATTTATTGACTTATGTATACTTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03410 Base excision repair > K04799 flap endonuclease-1; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K04799 flap endonuclease-1; Genetic Information Processing > Replication and Repair > ko03450 Non-homologous end-joining > K04799 flap endonuclease-1 |
| EC | 3.-.-.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832721 |
| Trichome-related Gene from Literature | N/A |