Detail of EST/Unigene AL378875 |
Acc. | AL378875 |
Internal Acc. | MtBB41A04R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide cyclase 4, chloroplastic OS=Arabidopsis thaliana E-value=9e-18; Allene oxide cyclase 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-17; Allene oxide cyclase 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-17; Allene oxide cyclase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-15; |
Length | 332 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | AAGGTGTTTATGGACAAGTTAAACTTCAACAACTTGTGTTCCCATTTAAGCTGTTCTACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837888 |
Trichome-related Gene from Literature | N/A |