| Detail of EST/Unigene AL379062 |
| Acc. | AL379062 |
| Internal Acc. | MtBB42C06F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome c1-2, heme protein, mitochondrial (Fragment) OS=Solanum tuberosum E-value=9e-20; Cytochrome c1-1, heme protein, mitochondrial OS=Solanum tuberosum E-value=1e-19; Cytochrome c1, heme protein, mitochondrial OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=4e-11; Cytochrome c1, heme protein, mitochondrial OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=8e-11; Cytochrome c1, heme protein, mitochondrial OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=2e-10; |
| Length | 133 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | TCGTGACCCCCCTGCTGGTGTTTCGATCAGAGAAGGATTGCATTACAATCCTTACTTCCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00190 Oxidative phosphorylation > K00413 ubiquinol-cytochrome c reductase cytochrome c1 subunit |
| EC | 1.10.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | 3.D.3 Proton-translocating quinol-cyt c reductase superfamily QCR |
| Probeset |
|
| Corresponding NCBI Gene | 834081 |
| Trichome-related Gene from Literature | N/A |