| Detail of EST/Unigene AL379191 |
| Acc. | AL379191 |
| Internal Acc. | MtBB43G07F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 9S-lipoxygenase OS=Lens culinaris E-value=1e-41; Seed linoleate 9S-lipoxygenase-3 OS=Glycine max E-value=3e-40; Linoleate 9S-lipoxygenase-4 OS=Glycine max E-value=2e-39; Seed linoleate 9S-lipoxygenase-2 OS=Pisum sativum E-value=3e-39; Seed linoleate 9S-lipoxygenase-2 OS=Glycine max E-value=9e-39; |
| Length | 337 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | AGTAAATGAAACTGAAGCAAAGACCTATGCTGCTAGAACCATTCTTTTTGTTAAAGATGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00458 arachidonate 12-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00460 arachidonate 15-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00460 arachidonate 15-lipoxygenase |
| EC | 1.13.11.31 1.13.11.33 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821808 |
| Trichome-related Gene from Literature | N/A |