Detail of EST/Unigene AL379241 |
Acc. | AL379241 |
Internal Acc. | MtBB44B09F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Methionine aminopeptidase 1B, chloroplastic OS=Arabidopsis thaliana E-value=4e-68; Methionine aminopeptidase 1C, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=3e-63; Methionine aminopeptidase 1D, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=2e-54; Methionine aminopeptidase 1D, mitochondrial OS=Dictyostelium discoideum E-value=2e-44; Methionine aminopeptidase 1D, mitochondrial OS=Homo sapiens E-value=6e-43; |
Length | 418 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | CGTGCCGTGAGCTTGCAGCACGTGTCTTGAACTTCGCTGGAACTTTGGTTAGGCCTTCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.11.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837887 |
Trichome-related Gene from Literature | N/A |