Detail of EST/Unigene AL379243 |
Acc. | AL379243 |
Internal Acc. | MtBB44B10F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Dynein light chain 2, cytoplasmic OS=Rattus norvegicus E-value=5e-32; Dynein light chain 2, cytoplasmic OS=Mus musculus E-value=5e-32; Dynein light chain 2, cytoplasmic OS=Homo sapiens E-value=5e-32; Dynein light chain 2, cytoplasmic OS=Bos taurus E-value=5e-32; Dynein light chain 1, cytoplasmic OS=Caenorhabditis elegans E-value=6e-32; |
Length | 425 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | TGCAAGAGAGAGAATTAGGTAAAGAAAGATGAGCGAGGAGGCGAAGAAGCACAGCGCAGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827275 |
Trichome-related Gene from Literature | N/A |