| Detail of EST/Unigene AL379554 |
| Acc. | AL379554 |
| Internal Acc. | MtBB46A05R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Superoxide dismutase [Mn], mitochondrial OS=Prunus persica E-value=8e-31; Superoxide dismutase [Mn], mitochondrial OS=Nicotiana plumbaginifolia E-value=5e-30; Superoxide dismutase [Mn], mitochondrial OS=Hevea brasiliensis E-value=7e-30; Superoxide dismutase [Mn], mitochondrial OS=Arabidopsis thaliana E-value=9e-30; Superoxide dismutase [Mn], mitochondrial OS=Capsicum annuum E-value=1e-29; |
| Length | 451 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | TTGAAGAGGCTTGTGGTTGAAACCACTGCAAACCAGGACCCATTGGTTACTAAAGGAACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.15.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820263 |
| Trichome-related Gene from Literature | N/A |