Detail of EST/Unigene AL379554 |
Acc. | AL379554 |
Internal Acc. | MtBB46A05R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Superoxide dismutase [Mn], mitochondrial OS=Prunus persica E-value=8e-31; Superoxide dismutase [Mn], mitochondrial OS=Nicotiana plumbaginifolia E-value=5e-30; Superoxide dismutase [Mn], mitochondrial OS=Hevea brasiliensis E-value=7e-30; Superoxide dismutase [Mn], mitochondrial OS=Arabidopsis thaliana E-value=9e-30; Superoxide dismutase [Mn], mitochondrial OS=Capsicum annuum E-value=1e-29; |
Length | 451 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | TTGAAGAGGCTTGTGGTTGAAACCACTGCAAACCAGGACCCATTGGTTACTAAAGGAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.15.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820263 |
Trichome-related Gene from Literature | N/A |