Detail of EST/Unigene AL379779 |
Acc. | AL379779 |
Internal Acc. | MtBB47D09F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=2e-51; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=3e-44; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=8e-22; Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=1e-19; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=5e-19; |
Length | 470 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | AGAACAAGTACCAGAGCAGTGAGAATCTAGAGATAGAGAGAACAATGGCAAGAGGGTTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835760 |
Trichome-related Gene from Literature | N/A |