Detail of EST/Unigene AL380000 |
Acc. | AL380000 |
Internal Acc. | MtBB48F12R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S19, mitochondrial OS=Petunia hybrida E-value=2e-22; 40S ribosomal protein S19, mitochondrial OS=Arabidopsis thaliana E-value=2e-20; Ribosomal protein S19, mitochondrial OS=Marchantia polymorpha E-value=2e-12; Ribosomal protein S19, mitochondrial OS=Prototheca wickerhamii E-value=4e-12; Ribosomal protein S19, mitochondrial OS=Platymonas subcordiformis E-value=2e-10; |
Length | 351 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | TGAAGAAGAATCCAGAACTTCTGAAGAACAAACAAATTTGGTCAAGAAGATCTACTATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834779 |
Trichome-related Gene from Literature | N/A |