Detail of EST/Unigene AL380191 |
Acc. | AL380191 |
Internal Acc. | MtBB51A01R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-Cys peroxiredoxin BAS1-like, chloroplastic OS=Arabidopsis thaliana E-value=8e-37; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Arabidopsis thaliana E-value=1e-36; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-35; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Spinacia oleracea E-value=1e-33; 2-Cys peroxiredoxin BAS1, chloroplastic (Fragment) OS=Hordeum vulgare E-value=4e-33; |
Length | 406 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | AGGGAATTGCATTGAGAGGATTGTTCATTATTGACAAGGAAGGGATTATTCAGCACTCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.11.1.15 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830517 |
Trichome-related Gene from Literature | N/A |