| Detail of EST/Unigene AL380479 |
| Acc. | AL380479 |
| Internal Acc. | MtBB52F09R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=1e-14; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=3e-14; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=9e-14; Glucan endo-1,3-beta-glucosidase-like protein 3 OS=Arabidopsis thaliana E-value=1e-13; Glucan endo-1,3-beta-glucosidase-like protein 2 OS=Arabidopsis thaliana E-value=5e-13; |
| Length | 494 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | GCTTTGGATTATGCTTGTGGTGAAGGTGGTGCTGATTGTTTAGAGATTACTACTCCACAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836882 |
| Trichome-related Gene from Literature | N/A |