Detail of EST/Unigene AL380983 |
Acc. | AL380983 |
Internal Acc. | MtBB55G11F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase-like protein 3 OS=Arabidopsis thaliana E-value=1e-32; Glucan endo-1,3-beta-glucosidase-like protein 2 OS=Arabidopsis thaliana E-value=1e-29; Glucan endo-1,3-beta-glucosidase-like protein At1g69295 OS=Arabidopsis thaliana E-value=6e-22; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=9e-21; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=6e-19; |
Length | 469 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD; |
Sequence | ACCTTTTAGCTCTTCCACGTTTTTCATTGCTATCTAAAACACACACCATTAACTCATCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838446 |
Trichome-related Gene from Literature | N/A |