| Detail of EST/Unigene AL381148 |
| Acc. | AL381148 |
| Internal Acc. | MtBB57B12F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Brassica napus E-value=9e-10; Thioredoxin M1, chloroplastic OS=Arabidopsis thaliana E-value=2e-08; Thioredoxin M2, chloroplastic OS=Arabidopsis thaliana E-value=8e-08; Thioredoxin OS=Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) E-value=8e-08; Thioredoxin OS=Porphyra yezoensis E-value=4e-07; |
| Length | 162 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD; |
| Sequence | TTCGCTCCATTGTGTAGCCCCTGCAAGAATGTTGATTTCAAAATGGTTGAGCTGGCAAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839436 |
| Trichome-related Gene from Literature | N/A |