| Detail of EST/Unigene ALFCAD1A |
| Acc. | ALFCAD1A |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable mannitol dehydrogenase OS=Medicago sativa E-value=0; Probable mannitol dehydrogenase 1 OS=Stylosanthes humilis E-value=0; Probable cinnamyl alcohol dehydrogenase 9 OS=Arabidopsis thaliana E-value=0; Cinnamyl alcohol dehydrogenase 3 OS=Arabidopsis thaliana E-value=0; Cinnamyl alcohol dehydrogenase 2 OS=Arabidopsis thaliana E-value=0; |
| Length | 1390 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_CDS; |
| Sequence | GTATAAGTCAATAAATACACCAACACTACGCTATTACACTTCACTTCATTCACATATCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
| EC | 1.-.-.- 1.1.1.1 1.1.1.14 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830088 |
| Trichome-related Gene from Literature | N/A |