Detail of EST/Unigene ALFGS |
Acc. | ALFGS |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase cytosolic isozyme OS=Medicago sativa E-value=5e-48; Glutamine synthetase nodule isozyme OS=Vigna aconitifolia E-value=4e-46; Glutamine synthetase cytosolic isozyme 1 OS=Glycine max E-value=8e-46; Glutamine synthetase PR-1 OS=Phaseolus vulgaris E-value=1e-45; Glutamine synthetase cytosolic isozyme 1 OS=Vitis vinifera E-value=2e-45; |
Length | 276 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_CDS; |
Sequence | TCATCTTGAAAGCAATTGAGAAGCTTGGGAAGAAGCACAAGGAGCACATTGCTGCTTATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831519 |
Trichome-related Gene from Literature | N/A |