| Detail of EST/Unigene AM784212 |
| Acc. | AM784212 |
| Internal Acc. | AM784212 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=3e-61; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=1e-47; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=4e-46; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=1e-45; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=1e-45; |
| Length | 514 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_COL; |
| Sequence | AAGCGTTAAAAAAAGCCCTGTCTTTCTTGTAGCTTTGTTTTCAAGAGAGAAATAATGGGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820288 |
| Trichome-related Gene from Literature | 820288 |