Detail of EST/Unigene AM784212 |
Acc. | AM784212 |
Internal Acc. | AM784212 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=3e-61; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=1e-47; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=4e-46; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=1e-45; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=1e-45; |
Length | 514 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_COL; |
Sequence | AAGCGTTAAAAAAAGCCCTGTCTTTCTTGTAGCTTTGTTTTCAAGAGAGAAATAATGGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |