Detail of EST/Unigene AM787854 |
Acc. | AM787854 |
Internal Acc. | AM787854 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-23; Allene oxide synthase OS=Parthenium argentatum E-value=3e-22; Allene oxide synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-21; Allene oxide synthase, chloroplastic OS=Linum usitatissimum E-value=5e-21; 9-divinyl ether synthase OS=Capsicum annuum E-value=8e-16; |
Length | 204 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_DL; |
Sequence | CTGGAAAAGCTATTGAAGCATGTATTATGGTCTAACGGACCTGAAACGGAGAGTCCGACG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834273 |
Trichome-related Gene from Literature | 834273 |