| Detail of EST/Unigene AM787854 |
| Acc. | AM787854 |
| Internal Acc. | AM787854 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-23; Allene oxide synthase OS=Parthenium argentatum E-value=3e-22; Allene oxide synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-21; Allene oxide synthase, chloroplastic OS=Linum usitatissimum E-value=5e-21; 9-divinyl ether synthase OS=Capsicum annuum E-value=8e-16; |
| Length | 204 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_DL; |
| Sequence | CTGGAAAAGCTATTGAAGCATGTATTATGGTCTAACGGACCTGAAACGGAGAGTCCGACG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834273 |
| Trichome-related Gene from Literature | 834273 |