Detail of EST/Unigene AM807242 |
Acc. | AM807242 |
Internal Acc. | AM807242 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=3e-22; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=9e-21; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=2e-20; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=2e-17; 30S ribosomal protein S14 OS=Prosthecochloris aestuarii (strain DSM 271 / SK 413) E-value=2e-14; |
Length | 480 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_SL; |
Sequence | AAAATCAGAAGTTTCAGGACAATGAAAAGCTTTAGCAAGGTTCCACCAAGCAGATTCAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818015 |
Trichome-related Gene from Literature | 818015 |