Detail of EST/Unigene AM811995 |
Acc. | AM811995 |
Internal Acc. | AM811995 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | tRNA dimethylallyltransferase 2 OS=Arabidopsis thaliana E-value=2e-20; Adenylate isopentenyltransferase 7, mitochondrial OS=Arabidopsis thaliana E-value=1e-10; Adenylate isopentenyltransferase 5, chloroplastic OS=Arabidopsis thaliana E-value=4e-09; Adenylate isopentenyltransferase 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-09; Adenylate isopentenyltransferase 8, chloroplastic OS=Arabidopsis thaliana E-value=8e-06; |
Length | 529 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_COL; |
Sequence | GATATGATGTATATTCTGCCTCAATGTCTGATCATTTAGTGCCTGAAGGTAAGATTCACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817322 |
Trichome-related Gene from Literature | 817322 |