| Detail of EST/Unigene AM823571 |
| Acc. | AM823571 |
| Internal Acc. | AM823571 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione synthetase, chloroplastic OS=Solanum lycopersicum E-value=3e-12; Glutathione synthetase, chloroplastic OS=Brassica juncea E-value=3e-09; Glutathione synthetase, chloroplastic OS=Arabidopsis thaliana E-value=2e-08; |
| Length | 105 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_DL; |
| Sequence | TGCTCTTTTACCAATGTCATTCCCTGAAAGTCAATGGAAGCAAGCTTGTGAAGTTGCTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832797 |
| Trichome-related Gene from Literature | 832797 |