Detail of EST/Unigene AM828092 |
Acc. | AM828092 |
Internal Acc. | AM828092 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum E-value=5e-15; 30S ribosomal protein S17, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-14; 30S ribosomal protein S17, chloroplastic OS=Zea mays E-value=3e-14; 30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana E-value=2e-13; 30S ribosomal protein S17 OS=Rhodobacter sphaeroides (strain KD131 / KCTC 12085) E-value=2e-06; |
Length | 388 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_DL; |
Sequence | AATAAATTCCCCATCTAAAAATAAGTATCAAAATACATGATTATCATGAAAGCACAACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844324 |
Trichome-related Gene from Literature | 844324 |