| Detail of EST/Unigene AM832029 |
| Acc. | AM832029 |
| Internal Acc. | AM832029 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=6e-43; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=4e-31; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=1e-29; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=6e-29; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=8e-29; |
| Length | 459 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_COL; |
| Sequence | ATAAACCATGAAACATGTAGGCACAAATAGCGTTAAAAAAAGCCCTGTTCTTTCTTGTAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820288 |
| Trichome-related Gene from Literature | 820288 |