Detail of EST/Unigene AM832029 |
Acc. | AM832029 |
Internal Acc. | AM832029 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=6e-43; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=4e-31; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=1e-29; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=6e-29; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=8e-29; |
Length | 459 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_COL; |
Sequence | ATAAACCATGAAACATGTAGGCACAAATAGCGTTAAAAAAAGCCCTGTTCTTTCTTGTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |