| Detail of EST/Unigene AW034585 | 
| Acc. | AW034585 | 
| Internal Acc. | EST278269 | 
| Type | EST | 
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=4e-88; Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=4e-85; Trans-cinnamate 4-monooxygenase OS=Helianthus tuberosus E-value=3e-84; Trans-cinnamate 4-monooxygenase OS=Petroselinum crispum E-value=2e-83; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=2e-83; | 
| Length | 527 nt | 
| Species | Solanum lycopersicum | 
| Belonged EST Libraries | SL_TAMU_CALLUS; | 
| Sequence | GTTTGATAGGAGATTTGAGAGTGAAGATGATCCCCTTTTTGTTAAGCTTAGGGCTTTGAA | 
| EST members of Unigene | N/A | 
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 | 
| EC | 1.14.14.1 | 
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset | 
 
  | 
| Corresponding NCBI Gene | 817599 | 
| Trichome-related Gene from Literature | 817599 |