Detail of EST/Unigene AW041331 |
Acc. | AW041331 |
Internal Acc. | EST284195 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=3e-40; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=7e-39; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=7e-39; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=9e-39; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=3e-38; |
Length | 305 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_CELL_BTI; |
Sequence | GAGATTCTCATTCTACTTCTATAATGGCTACTTCTACCATGGCTCTTTCTTCCTCTACAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |