| Detail of EST/Unigene AW094562 |
| Acc. | AW094562 |
| Internal Acc. | EST287742 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=1e-39; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=1e-39; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=1e-39; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-39; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=2e-39; |
| Length | 332 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_CELL_BTI; |
| Sequence | ATAAGAAAAATCAATTCTATTGTTCAAGTAAACTCACAAATTACAACTTTACATGGTCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818005 |
| Trichome-related Gene from Literature | N/A |