Detail of EST/Unigene AW216998 |
Acc. | AW216998 |
Internal Acc. | EST295712 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform PR-Q' OS=Nicotiana tabacum E-value=2e-35; Glucan endo-1,3-beta-glucosidase OS=Glycine max E-value=7e-23; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Prunus persica E-value=2e-22; Glucan endo-1,3-beta-glucosidase, acidic isoform OS=Arabidopsis thaliana E-value=2e-22; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=3e-22; |
Length | 279 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_TAMU_CALLUS; |
Sequence | GCGCAGTATGTGCCTTTCGTGATCAATGCAATGAGAAACATTCAGAACGCGATTTCTGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |