Detail of EST/Unigene AW217700 |
Acc. | AW217700 |
Internal Acc. | EST296414 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=2e-41; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-19; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-14; Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-06; |
Length | 493 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_FLOWERBUDS3; |
Sequence | ATCAAAGATTCATTTTTTTTTTCACTTACCCTCCAATTACATCTTCATAAACAACATTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827230 |
Trichome-related Gene from Literature | 827230 |