| Detail of EST/Unigene AW217700 |
| Acc. | AW217700 |
| Internal Acc. | EST296414 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=2e-41; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-19; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-14; Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-06; |
| Length | 493 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_FLOWERBUDS3; |
| Sequence | ATCAAAGATTCATTTTTTTTTTCACTTACCCTCCAATTACATCTTCATAAACAACATTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827230 |
| Trichome-related Gene from Literature | 827230 |