| Detail of EST/Unigene AW222561 |
| Acc. | AW222561 |
| Internal Acc. | EST299372 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 9S-lipoxygenase B OS=Solanum lycopersicum E-value=2e-74; Linoleate 9S-lipoxygenase A OS=Solanum lycopersicum E-value=2e-58; Probable linoleate 9S-lipoxygenase 5 OS=Solanum tuberosum E-value=4e-58; Linoleate 9S-lipoxygenase 6 (Fragment) OS=Solanum tuberosum E-value=8e-58; Probable linoleate 9S-lipoxygenase 4 OS=Solanum tuberosum E-value=2e-57; |
| Length | 445 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_RIP_FRUIT_TAMU; |
| Sequence | TCAGCAGTTTTCTGATCAGGTTCAAAACCTTTGGGGGAAAATTAACATGTCAGCAAACAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00458 arachidonate 12-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00460 arachidonate 15-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00460 arachidonate 15-lipoxygenase |
| EC | 1.13.11.31 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821808 |
| Trichome-related Gene from Literature | N/A |