| Detail of EST/Unigene AW223201 |
| Acc. | AW223201 |
| Internal Acc. | EST300012 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 9S-lipoxygenase B OS=Solanum lycopersicum E-value=0; Linoleate 9S-lipoxygenase A OS=Solanum lycopersicum E-value=2e-82; Linoleate 9S-lipoxygenase 6 (Fragment) OS=Solanum tuberosum E-value=3e-82; Linoleate 9S-lipoxygenase 1 OS=Solanum tuberosum E-value=3e-82; Probable linoleate 9S-lipoxygenase 5 OS=Solanum tuberosum E-value=4e-82; |
| Length | 561 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_RIP_FRUIT_TAMU; |
| Sequence | GCCTACTTAAGTACCCAACTCCTCAGGTTATTCAAGGCGATAAAACTGCATGGAGGACGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08021 arachidonate 12-lipoxygenase (R-type) |
| EC | 1.13.11.- 1.13.11.34 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821808 |
| Trichome-related Gene from Literature | N/A |