| Detail of EST/Unigene AW223512 |
| Acc. | AW223512 |
| Internal Acc. | EST300323 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Homo sapiens E-value=1e-23; Gamma-glutamyltransferase light chain 1 OS=Homo sapiens E-value=3e-23; Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=4e-23; Gamma-glutamyltransferase light chain 2 OS=Homo sapiens E-value=4e-22; Gamma-glutamyltranspeptidase 1 OS=Sus scrofa E-value=7e-22; |
| Length | 352 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_RIP_FRUIT_TAMU; |
| Sequence | AAGAAATTCAACAAAAGATCTTTGACAATACCACCTTTCCTCCTGAATACTATTTGCCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
| EC | 2.3.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829042 |
| Trichome-related Gene from Literature | 829042 |