Detail of EST/Unigene AW223518
Acc. AW223518
Internal Acc. EST300329
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 40S ribosomal protein S13 OS=Glycine max E-value=8e-11; 40S ribosomal protein S13 OS=Pisum sativum E-value=2e-08; 40S ribosomal protein S13-2 OS=Arabidopsis thaliana E-value=8e-08; 40S ribosomal protein S13-1 OS=Arabidopsis thaliana E-value=1e-07; 40S ribosomal protein S13-2 OS=Oryza sativa subsp. japonica E-value=7e-07;
Length 117 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_RIP_FRUIT_TAMU;
Sequence AGCTTTTGCTCTCCCTTACAAGAGAACTCCTCCTAGTTGGCTCAAGATCTCTGCTCCAGA
TGTTGAGGACAACATCTGCAAGGTCGCTTAGAAAGGATTGACCCCTTCACAGACTGG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Genetic Information Processing > Translation > ko03010 Ribosome > K02953 small subunit ribosomal protein S13e
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 828167 
Trichome-related Gene from Literature 828167