| Detail of EST/Unigene AW254995 |
| Acc. | AW254995 |
| Internal Acc. | ML1176 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=3e-45; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-44; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=7e-44; Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-43; 1-deoxy-D-xylulose-5-phosphate synthase OS=Mesorhizobium sp. (strain BNC1) E-value=3e-35; |
| Length | 366 nt |
| Species | Mentha x piperita |
| Belonged EST Libraries | MP_TRI; |
| Sequence | GAGGGAACGGCATCGGCGTCGCTCTTCCGTCGAACAACAAAGGAACTCCATTAGAGATTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K00162 pyruvate dehydrogenase E1 component subunit beta; Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00162 pyruvate dehydrogenase E1 component subunit beta; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00162 pyruvate dehydrogenase E1 component subunit beta; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00162 pyruvate dehydrogenase E1 component subunit beta; Metabolism > Amino Acid Metabolism > ko00290 Valine, leucine and isoleucine biosynthesis > K00162 pyruvate dehydrogenase E1 component subunit beta |
| EC | 1.2.4.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827230 |
| Trichome-related Gene from Literature | 827230 |