| Detail of EST/Unigene AW429051 |
| Acc. | AW429051 |
| Internal Acc. | EST306423 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=1e-52; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=5e-52; Trans-cinnamate 4-monooxygenase OS=Populus tremuloides E-value=9e-52; Trans-cinnamate 4-monooxygenase OS=Vigna radiata var. radiata E-value=1e-51; Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=1e-51; |
| Length | 353 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_flowerbuds4; |
| Sequence | AAGACCTTCATAGGTCTTTTCTATGCCATTTTAATCGCTATTATCATCTCTAAACTTCGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07411 cytochrome P450, family 2, subfamily A |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817599 |
| Trichome-related Gene from Literature | 817599 |