Detail of EST/Unigene AW443272 |
Acc. | AW443272 |
Internal Acc. | EST308202 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=1e-63; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=2e-51; Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=5e-51; Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=1e-47; Chlorophyll a-b binding protein AB10, chloroplastic OS=Malus domestica E-value=3e-41; |
Length | 530 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_CELL_BTI; |
Sequence | CTCTTCAACAATATTTAATACCATAAAATACTCAACACTTTTCTCTTAATATAAATCATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |