| Detail of EST/Unigene AW443272 |
| Acc. | AW443272 |
| Internal Acc. | EST308202 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=1e-63; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=2e-51; Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=5e-51; Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=1e-47; Chlorophyll a-b binding protein AB10, chloroplastic OS=Malus domestica E-value=3e-41; |
| Length | 530 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_CELL_BTI; |
| Sequence | CTCTTCAACAATATTTAATACCATAAAATACTCAACACTTTTCTCTTAATATAAATCATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818005 |
| Trichome-related Gene from Literature | N/A |