Detail of EST/Unigene AW443363
Acc. AW443363
Internal Acc. EST308293
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase small chain 3, chloroplastic OS=Solanum tuberosum E-value=2e-11; Ribulose bisphosphate carboxylase small chain 3B, chloroplastic OS=Solanum lycopersicum E-value=2e-11; Ribulose bisphosphate carboxylase small chain 3A/3C, chloroplastic OS=Solanum lycopersicum E-value=2e-11; Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Solanum tuberosum E-value=2e-11; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Nicotiana tabacum E-value=1e-10;
Length 89 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_CELL_BTI;
Sequence AGACTGAGCACGGATGTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGCA
CATACTGGACCATGTGGAAGCTGCCCATG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 843029 
Trichome-related Gene from Literature 843029