| Detail of EST/Unigene AW616885 |
| Acc. | AW616885 |
| Internal Acc. | EST323296 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aldehyde dehydrogenase OS=Craterostigma plantagineum E-value=3e-42; Aldehyde dehydrogenase family 3 member I1, chloroplastic OS=Arabidopsis thaliana E-value=4e-41; Aldehyde dehydrogenase family 3 member H1 OS=Arabidopsis thaliana E-value=2e-40; Probable aldehyde dehydrogenase ywdH OS=Bacillus subtilis (strain 168) E-value=6e-22; Aldehyde dehydrogenase family 3 member B1 OS=Rattus norvegicus E-value=6e-21; |
| Length | 409 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SH_TRI; |
| Sequence | GAAGGAATTGAGAGGGTCGTACGGGAGTGGGAAGACGAAGAGTTACGAGTGGAGAGTGTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00129 aldehyde dehydrogenase (NAD(P)+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00129 aldehyde dehydrogenase (NAD(P)+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00129 aldehyde dehydrogenase (NAD(P)+); Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K00129 aldehyde dehydrogenase (NAD(P)+); Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00129 aldehyde dehydrogenase (NAD(P)+); Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00129 aldehyde dehydrogenase (NAD(P)+) |
| EC | 1.2.1.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829573 |
| Trichome-related Gene from Literature | 829573 |