| Detail of EST/Unigene AW617974 |
| Acc. | AW617974 |
| Internal Acc. | EST314048 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=2e-19; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=1e-12; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=5e-12; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=3e-11; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=4e-11; |
| Length | 490 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SP_TRI; |
| Sequence | GAGACAATCAACAAGAAACACAAGTTGAGATTTCTGTGCCTCTCTGTGGAATAAGGAGAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820288 |
| Trichome-related Gene from Literature | 820288 |