| Detail of EST/Unigene AW622963 |
| Acc. | AW622963 |
| Internal Acc. | EST320908 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=1e-84; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=2e-82; Trans-cinnamate 4-monooxygenase OS=Zinnia elegans E-value=6e-82; Trans-cinnamate 4-monooxygenase OS=Helianthus tuberosus E-value=5e-81; Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=2e-80; |
| Length | 498 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_flower_buds8; |
| Sequence | CCCTGAATCTGCTACAAATGGGATTGTTTTGAGGAAAAGATTGCAGCTTATGATGTATAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817599 |
| Trichome-related Gene from Literature | 817599 |