Detail of EST/Unigene AW623451 |
Acc. | AW623451 |
Internal Acc. | EST321396 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase OS=Hyoscyamus muticus E-value=9e-65; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=4e-50; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=7e-49; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=1e-39; Glutathione S-transferase F7 OS=Arabidopsis thaliana E-value=6e-37; |
Length | 446 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_flower_buds8; |
Sequence | CTCACACACAAATTTCATTGTCTACTTTCACTTTCTCTCTCTAGAAAACAAAAATGGCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819386 |
Trichome-related Gene from Literature | 819386 |