Detail of EST/Unigene AW624460 |
Acc. | AW624460 |
Internal Acc. | EST322405 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=3e-88; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=2e-87; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=4e-87; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=7e-87; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-86; |
Length | 534 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_flower_buds8; |
Sequence | ATTTATTAAAATTAAACCATGGCTGCTTCTACAATGGCTCTTTCCTCCTCTACCTTCGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |