Detail of EST/Unigene AW648558 |
Acc. | AW648558 |
Internal Acc. | EST327012 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=8e-17; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=4e-12; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=9e-11; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=6e-10; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=2e-09; |
Length | 479 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_germ_seedlings_TAMU; |
Sequence | CAAGGCTATCAACAGGAAACACAAGTTGAGATTGCTGTGCCTCCCTCTGTGGAATAAGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |