| Detail of EST/Unigene AW651466 |
| Acc. | AW651466 |
| Internal Acc. | EST329920 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=1e-71; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=9e-69; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-65; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. indica E-value=5e-65; Glutamate--cysteine ligase A, chloroplastic OS=Oryza sativa subsp. indica E-value=5e-65; |
| Length | 562 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_germ_seedlings_TAMU; |
| Sequence | GCAAATTCACCTTTCACTGAAGGAAAACCTAATGGTTATCTCAGCAAGAGAAGCCACATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828409 |
| Trichome-related Gene from Literature | 828409 |